Human PS6K / RPS6KB1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_003161.2

RefSeq ORF Size

1578bp

Gene Synonym

RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

References

Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.

Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.

Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.

Catalog Number:MGG187-NM