Mouse Progranulin/Granulin Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGG142-NG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1770bp
Gene Synonym
epithelin, Grn
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse granulin Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
&Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. Granulins have possible cytokine-like activity. They may play a role in inflammation, wound repair, and tissue remodeling. Granulin-4 promotes proliferation of the epithelial cell line A431 in culture while granulin-3 acts as an antagonist to granulin-4, inhibiting the growth. Granulin expression inhibited Tat transactivation, and tethering experiments showed that this effect was due, at least in part, to a direct action on cyclin T1 in the absence of Tat.
References
  • Hoque M, et al. (2003) The growth factor granulin interacts with cyclin T1 and modulates P-TEFb-dependent transcription. Mol Cell Biol. 23(5): 1688-702.
  • Bateman A, et al. (1990) Granulins, a novel class of peptide from leukocytes. Biochem Biophys Res Commun. 173(3): 1161-8.
  • Trinh DP, et al. (1999) Epithelin/granulin growth factors: extracellular cofactors for HIV-1 and HIV-2 Tat proteins. Biochem Biophys Res Commun. 256(2): 299-306.
  • TOP