Mouse PRL-2/PTP4A2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001164745.1

RefSeq ORF Size

504bp

Gene Synonym

Prl-2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse protein tyrosine phosphatase 4a2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PRL-2 (Protein-tyrosine phosphatase of regenerating liver 2), also known as PTP4A2 (Protein tyrosine phosphatase type IVA, member 2), is a member of PTP family and has an important function in controlling cell growth. PRL-2 phosphatases may be multifunctional enzymes with diverse roles in a variety of tissue and cell types. The phosphatase of regenerating liver (PRL) family, comprising PRL-1, PRL-2 and PRL-3, is a group of prenylated phosphatases that are candidate cancer biomarkers and therapeutic targets. PRL-1, PRL-2, and PRL-3 represent a novel class of protein-tyrosine phosphatase with a C-terminal prenylation motif. They are three closely related intracellular enzymes that possess the PTP active site signature sequence CX 5R. The PRL-2 mRNA is elevated in primary breast tumors relative to matched normal tissue, and also dramatically elevated in metastatic lymph nodes compared with primary tumors. PRL-2 plays a role in breast cancer progression. PRL-2 is a pathogenic molecule in hematopoietic malignancies and suggest its potential as a novel therapeutic target.

References

Akiyama S, et al. (2010) PRL-2 increases Epo and IL-3 responses in hematopoietic cells. Blood Cells Mol Dis. 44(4): 209-14.

Hardy S, et al. (2010) Overexpression of the protein tyrosine phosphatase PRL-2 correlates with breast tumor formation and progression. Cancer Res. 70(21): 8959-67.

Yuan L, et al. (2007) Differential expression and functional constraint of PRL-2 in hibernating bat. Comp Biochem Physiol B Biochem Mol Biol. 148(4): 375-81.

Dumaual CM, et al. (2006) Cellular localization of PRL-1 and PRL-2 gene expression in normal adult human tissues. J Histochem Cytochem. 54(12): 1401-12.

Zeng Q, et al. (2000) Prenylation-dependent association of protein-tyrosine phosphatases PRL-1, -2, and -3 with the plasma membrane and the early endosome. J Biol Chem. 275(28): 21444-52.

Catalog Number:MGG118-CF