Rat Prealbumin/Transthyretin Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:MGG087-NH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
444bp
Gene Synonym
Lr1, Tbpa
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat transthyretin Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Prealbumin/Transthyretin, also known as ATTR, Prealbumin, TTR and PALB, is a secreted and cytoplasm protein which belongs to the Prealbumin / Transthyretin family. Prealbumin / Transthyretin is detected in serum and cerebrospinal fluid (at protein level). It is highly expressed in choroid plexus epithelial cells. It is also detected in retina pigment epithelium and liver. Each monomer of Prealbumin / Transthyretin has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel. Prealbumin/Transthyretin is a carrier protein. It transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. Defects in Prealbumin / Transthyretin are the cause of amyloidosis type 1 (AMYL1) which is a hereditary generalized amyloidosis due to Prealbumin / Transthyretin amyloid deposition. Protein fibrils can form in different tissues leading to amyloid polyneuropathies, amyloidotic cardiomyopathy, carpal tunnel syndrome, systemic senile amyloidosis. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc.
References
  • Westermark P, et al. (1990) Fibril in senile systemic amyloidosis is derived from normal transthyretin. Proc Natl Acad Sci U S A. 87(7): 2843-5.
  • Colon W, et al. (1992) Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry. 31(36): 8654-60.
  • Hammarstrm P, et al. (2003) Prevention of transthyretin amyloid disease by changing protein misfolding energetics. Science. 299(5607): 713-6.
  • TOP