Rhesus PNLIP Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGF956-CM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1398bp
Gene Synonym
PNLIP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus pancreatic lipase Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PNLIP is an enzyme which belongs to the lipase family. Secreted from the pancreas, PNLIP is the primary lipase that hydrolyzes dietary fat molecules in the human digestive system, converting triglyceride substrates found in ingested oils to monoglycerides and free fatty acids. Bile salts secreted from the liver and stored in gallbladder are released into the duodenum where they coat and emulsify large fat droplets into smaller droplets, thus increasing the overall surface area of the fat, which allows the lipase to break apart the fat more effectively. The resulting monomers (2 free fatty acids and one 2-monoacylglycerol) are then moved by way of peristalsis along the small intestine to be absorbed into the lymphatic system by a specialized vessel called a lacteal.
References
  • Hegele RA, et al. (2001) Polymorphisms in PNLIP, encoding pancreatic lipase, and associations with metabolic traits. J Hum Genet. 46(6):320-4.
  • Thomas A, et al. (2005) Role of the lid hydrophobicity pattern in pancreatic lipase activity. J Biol Chem. 280(48):40074-83.
  • Colin DY, et al. (2008) Exploring the active site cavity of human pancreatic lipase. Biochem Biophys Res Commun. 370(3):394-8.
  • TOP