Mouse PLA2G7/PAFAH Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_013737.5

RefSeq ORF Size

1323bp

Gene Synonym

R75400

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Platelet-activating factor acetylhydrolase, also known as 1-alkyl-2-acetylglycerophosphocholine esterase, 2-acetyl-1-alkylglycero-phosphocholine esterase, Group-VIIA phospholipase A2, LDL-associated phospholipase A2, PAF 2-acylhydrolase, PLA2G7 and PAFAH, is secreted protein which belongs to the AB hydrolase superfamily and Lipase family. PLA2G7 / PAFAH modulates the action of platelet-activating factor (PAF) by hydrolyzing the sn-2 ester bond to yield the biologically inactive lyso-PAF. It has a specificity for substrates with a short residue at the sn-2 position. It is inactive against long-chain phospholipids. PLA2G7 / PAFAH is a potent pro- and anti-inflammatory molecule that has been implicated in multiple inflammatory disease processes, including cardiovascular disease. PLA2G7 also represents an important, potentially functional candidate in the pathophysiology of coronary artery disease (CAD). Defects in PLA2G7 are the cause of platelet-activating factor acetylhydrolase deficiency (PLA2G7 deficiency). It is a trait which is present in 27% of Japanese. It could have a significant physiologic effect in the presence of inflammatory bodily responses.

References

Stafforini D.M., et al., 1996, J. Clin. Invest. 97:2784-2791.

Yoshida H., et al., 1998, Thromb. Haemost. 80:372-375.

Yamada Y., et al., 1998, Metabolism 47:177-181.

Kruse S., et al., 2000, Am. J. Hum. Genet. 66:1522-1530.

Catalog Number:MGF897-CY