Mouse PLA2G2A Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGF893-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
441bp
Gene Synonym
EF, Mom1, Pla2, sPLA2, sPla2-IIA, Pla2g2a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse phospholipase A2, group IIA (platelets, synovial fluid) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Phospholipase A2, membrane associated, also known as Phosphatidylcholine 2-acylhydrolase 2A, Group IIA phospholipase A2, Non-pancreatic secretory phospholipase A2 and PLA2G2A, is a peripheral membrane protein which belongs to the phospholipase A2 family. PLA2G2A is found in many cells and also extracellularly. The membrane-bound and secreted forms of PLA2G2A are identical. PLA2G2A has been proposed to play a role in anti-bacterial defense, inflammation and eicosanoid generation, in clearance of apoptotic cells, and in the Wnt signaling pathway. PLA2G2A is thought to participate in the regulation of the phospholipid metabolism in biomembranes including eicosanoid biosynthesis. PLA2G2A catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. PLA2G2A might be a factor in human colorectal tumorigenesis.
References
  • Praml,C. et al., 1998, Oncogene. 17 (15):2009-12.
  • Fijneman,R.J. et al., 2008,Front Biosci 13 :4144-74.
  • Fijneman,R.J. et al., 2009, Cell Oncol  31 (5):345-56.
  • TOP