Mouse PLA2G1B Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGF892-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
441bp
Gene Synonym
Pla2a, MGC6679, sPLA2IB, Pla2g1b
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse phospholipase A2, group IB, pancreas Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
phospholipase A2, also known as Phosphatidylcholine 2-acylhydrolase 1B, Group IB phospholipase A2, PLA2 and PLA2G1B, is a secreted protein which belongs to the phospholipase A2 family. Phospholipase A2 / PLA2G1B catalyzes the release of fatty acids from glycero-3-phosphocholines. The best known varieties are the digestive enzymes secreted as zymogens by the pancreas of mammals. Sequences of pancreatic Phospholipase A2 / PLA2G1B enzymes from a variety of mammals have been reported. One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of Phospholipase A2 / PLA2G1B have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets. Mice lacking in Phospholipase A2 / PLA2G1B are resistant to obesity and diabetes induced by feeding a diabetogenic high-fat/high-carbohydrate diet. Oral supplementation of a diabetogenic diet with the PLA2G1B inhibitor methyl indoxam effectively suppresses diet-induced obesity and diabetes. PLA2G1B inhibition may be a potentially effective oral therapeutic option for treatment of obesity and diabetes.
References
  • Labonté,E.D. et al., 2006, Diabetes. 55 (4) :935-41.
  • Mounier,C.M. et al.,2008, Br J Cancer. 98 (3):587-95.
  • Hui,D.Y. et al., 2009, Br J Pharmacol. 157 (7):1263-9.
  • Labonté,E.D. et al., 2010, FASEB J. 24 (7):2516-24.
  • TOP