Mouse PKC iota Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGF877-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1788bp
Gene Synonym
Pkci, Pkcl, Prkcl, AI427505, KIAA4165, PKClambda, mKIAA4165, aPKClambda, 2310021H13Rik, Prkci
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse protein kinase C, iota Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein kinase C iota type, also known as Atypical protein kinase C-lambda/iota, aPKC-lambda/iota and PRKCI, is a cytoplasm, membrane and nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and PKC subfamily. PRKCI contains one AGC-kinase C-terminal domain, one OPR domain, one phorbol-ester/DAG-type zinc finger and one protein kinase domain. PRKCI is predominantly expressed in lung and brain, but also expressed at lower levels in many tissues including pancreatic islets. It is highly expressed in non-small cell lung cancers. PRKCI is a calcium-independent, phospholipid-dependent, serine- and threonine-specific kinase. It may play a role in the secretory response to nutrients. PRKCI is involved in cell polarization processes and the formation of epithelial tight junctions. It is implicated in the activation of several signaling pathways including Ras, c-Src and NF-kappa-B pathways. PRKCI functions in both pro- and anti-apoptotic pathways. It functions in the RAC1/ERK signaling required for transformed growth. PRKCI plays a role in microtubule dynamics through interaction with RAB2A and GAPDH and recruitment to vesicular tubular clusters (VTCs). PRKCI might be a target for novel lipid activators that are elevated during nutrient-stimulated insulin secretion.
References
  • Selbie L.A. et al.,1993, J. Biol. Chem. 268:24296-302.
  • Diaz-Meco M.T. et al.,1996, Mol. Cell. Biol. 16:105-114.
  • Noda Y. et al.,2001, Genes Cells 6:107-119.
  • White W.O.et al.,2002, J. Cell. Biochem. 85:42-53.
  • Messerschmidt A. et al., 2005, J. Mol. Biol. 352:918-931.
  • TOP