Mouse PGDH/PHGDH Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGF796-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1602bp
Gene Synonym
A10; PGD; PGAD; PGDH; SERA; 3PGDH; 3-PGDH; 4930479N23
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse 3-phosphoglycerate dehydrogenase Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PHGDH is a member of the D-isomer specific 2-hydroxyacid dehydrogenase family. This new family consists of D-isomer-stereospecific enzymes. The conserved residues in this family appear to be the residues involved in the substrate binding and the catalytic reaction, and thus to be targets for site-directed mutagenesis. A number of NAD-dependent 2-hydroxyacid dehydrogenases which seem to be specific for the D-isomer of their substrate have been shown to be functionally and structurally related. PHGDH catalyzes the transition of 3-phosphoglycerate into 3-phosphohydroxypyruvate, which is the first and rate-limiting step in the phosphorylated pathway of serine biosynthesis, using NAD+/NADH as a cofactor. Overexpression of PHGDH may cause certain breast cancers. Defects in PHGDH are the cause of phosphoglycerate dehydrogenase deficiency which is characterized by congenital microcephaly, psychomotor retardation, and seizures.
References
  • Pind S, et al. (2002) V490M, a common mutation in 3-phosphoglycerate dehydrogenase deficiency, causes enzyme deficiency by decreasing the yield of mature enzyme. J Biol Chem. 277 (9): 7136-43.
  • Du H, et al. (2010) 3-Phosphoglycerate dehydrogenase expression is regulated by HOXA10 in murine endometrium and human endometrial cells. Reproduction. 139 (1): 237-45.
  • Possemato R, et al. (2011) Functional genomics reveal that the serine synthesis pathway is essential in breast cancer. Nature. 476 (7360): 346-50.
  • TOP