Mouse Peroxiredoxin 5/PRDX5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGF758-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
633bp
Gene Synonym
AOPP, PrxV, Pmp20, Prdx6, AOEB166, Prdx5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse peroxiredoxin 5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Peroxiredoxin-5, also known as Alu corepressor 1, Antioxidant enzyme B166, Liver tissue 2D-page spot 71B, Peroxisomal antioxidant enzyme, Thioredoxin peroxidase PMP20, Thioredoxin reductase, PRDX5 and ACR1, is cytoplasm protein which belongs to the?peroxiredoxin 2 family. Peroxiredoxin-5 / PRDX5 reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-5 / PRDX5 is involved in intracellular redox signaling. The Peroxiredoxins / Prx are a family of 25 kDa peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.
References
  • Seo M.S., et al., 2000, J. Biol. Chem. 275: 20346-54.
  • Declercq J.-P., et al., 2001, J. Mol. Biol. 311:751-9.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • TOP