Mouse PDHA1 / C54G1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_008810.2

RefSeq ORF Size

1173bp

Gene Synonym

Pdha-1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse pyruvate dehydrogenase E1 alpha 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PDHA1, also known as C54G1, is an alpha subunit of pyruvate dehydrogenase. Pyruvate dehydrogenase, together with dihydrolipoamide acetyltransferase and lipoamide dehydrogenase, composes the pyruvate dehydrogenase (PDH) complex. The PDH complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. PDHA1 plays a key role in the function of the PDH complex. Defects in PDHA1 can cause pyruvate dehydrogenase E1-alpha deficiency. Defects in PDHA1 also are the cause of X-linked Leigh syndrome (X-LS). X-LS is an early-onset progressive neurodegenerative disorder with a characteristic neuropathology consisting of focal, bilateral lesions in one or more areas of the central nervous system, including the brainstem, thalamus, basal ganglia, cerebellum, and spinal cord.

References

Quintana E. et al., 2010, Clin Genet. 77 (5): 474-82.

Ah Mew N. et al., 2011, Pediatr Neurol. 45 (1): 57-9.

Pinheiro A. et al., 2012, Gene. 506 (1): 173-8.

Catalog Number:MGF714-NM