Mouse PDE4B Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGF699-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1695bp
Gene Synonym
Dpde4; dunce; R74983
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse phosphodiesterase 4B, cAMP specific Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents
References
  • Bolger G.et al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card G.L.et al., 2004, Structure 12:2233-47.
  • Card G.L.et al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang H.et al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • TOP