Mouse PAH / PH Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGF593-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1362bp
Gene Synonym
AW106920
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse phenylalanine hydroxylase Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PAH (phenylalanine hydroxylase), also known as PH, belongs to the biopterin-dependent aromatic amino acid hydroxylase family. It contains 1 ACT domain, N-terminal region of PAH is thought to contain allosteric binding sites for phenylalanine and to constitute an "inhibitory" domain that regulates the activity of a catalytic domain in the C-terminal portion of the molecule. In humans, PAH is expressed both in the liver and the kidney, and there is some indication that it may be differentially regulated in these tissues. PAH catalyzes the hydroxylation of the aromatic side-chain of phenylalanine to generate tyrosine. It is one of three members of the pterin-dependent amino acid hydroxylases, a class of monooxygenase that uses tetrahydrobiopterin and a non-heme iron for catalysis. Defects in PAH are the cause of phenylketonuria (PKU). PKU is an autosomal recessive inborn error of phenylalanine metabolism, due to severe phenylalanine hydroxylase deficiency. It is characterized by blood concentrations of phenylalanine persistently above 1200 mumol.
References
  • Fitzpatrick PF, et al. (1999) Tetrahydropterin-dependent amino acid hydroxylases. Annu Rev Biochem. 68:355-81.
  • Olsson E, et al. (2011) Formation of the iron-oxo hydroxylating species in the catalytic cycle of aromatic amino acid hydroxylases. Chemistry. 17(13):3746-58.
  • Bassan A, et al. (2003) Mechanism of aromatic hydroxylation by an activated FeIVO core in tetrahydrobiopterin-dependent hydroxylases. Chemistry. 9(17):4055-67.
  • Panay AJ, et al. (2011) Evidence for a high-spin Fe(IV) species in the catalytic cycle of a bacterial phenylalanine hydroxylase. Biochemistry. 50(11):1928-33.
  • Bassan A, et al. (2003) Mechanism of dioxygen cleavage in tetrahydrobiopterin-dependent amino acid hydroxylases. Chemistry. 9(1):106-15.
  • TOP