Mouse p38 delta/MAPK13 Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:MGF570-CH

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1101bp
Gene Synonym
SAPK4, Serk4, Mapk13
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase 13 Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The p38 family of mitogen-activated protein kinases (MAPK) includes p38 alpha (SAPK2a, CSBP), p38 beta (SAPK2b), p38 delta (SAPK4), and p38 gamma (SAPK3/ERK6). p38 alpha and p38 beta are widely expressed p38 isoforms that are involved in regulation of cell proliferation, differentiation, development, and response to stress. p38 delta, also known as MAPK13, is a regulator of differentiation-dependent gene expression in keratinocytes, and been as a regulator of surface epithelia differentiation and apoptosis. p38 delta protein is upregulated in Cholangiocarcinoma (CC) relative to hepatocellularcarcinoma (HCC) and to normal biliary tract tissues. p38 delta is important for motility and invasion of CC cells, suggesting that p38 delta may play an important role in CC metastasis. p38 delta is expressed in the epidermis, suggesting a role for p38 delta in regulating differentiation. p38 delta is the major p38 isoform driving suprabasal involucrin gene expression and that p38 delta directly regulates ERK1/2 activity via formation of a p38 delta-ERK1/2 complex. Recent emerging evidence suggests that the p38 stress MAPK pathway may function as a tumor suppressor through regulating Ras-dependent and -independent proliferation, transformation, invasion and cell death by isoform-specific mechanisms. p38 delta has important role in promoting cell proliferation and tumor development in epidermis and may have therapeutic implication for skin cancer.
References
  • Efimova T, et al. (2003) A regulatory role for p38 delta MAPK in keratinocyte differentiation. Evidence for p38 delta-ERK1/2 complex formation. J Biol Chem. 278(36): 34277-85.
  • Eckert RL, et al. (2003) p38 Mitogen-activated protein kinases on the body surface--a function for p38 delta. J Invest Dermatol. 120(5): 823-8.
  • Loesch M, et al. (2008) The p38 MAPK stress pathway as a tumor suppressor or more? Front Biosci. 13: 3581-93.
  • Schindler EM, et al. (2009) p38delta Mitogen-activated protein kinase is essential for skin tumor development in mice. Cancer Res. 69(11): 4648-55.
  • Tan FL, et al. (2010) p38delta/MAPK13 as a diagnostic marker for cholangiocarcinoma and its involvement in cell motility and invasion. Int J Cancer. 126(10): 2353-61.
  • TOP