Mouse OSTM1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_172416.3

RefSeq ORF Size

1017bp

Gene Synonym

gl, HSPC019, 1200002H13Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse osteopetrosis associated transmembrane protein 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Osteopetrosis-associated transmembrane protein 1 (OSTM1) is a Single-pass type I membrane protein. It is expressed in many hematopoietic cells of the myeloid and lymphoid B- and T-lineages. The analysis of OSTM1 association with CLCN7 demonstrated that OSTM1 requires CLCN7 to localize to lysosomes, whereas the formation of a CLCN7-OSTM1 complex is required to stabilize CLCN7. The researches found that OSTM1 plays a major role in myelopoiesis and lymphopoiesis and provided evidence of a crosstalk mechanism between hematopoietic cells for osteoclast activation. Thus, OSTM1 has a important role in osteoclast function and activation. The loss of function of OSTM1 results in deregulation of multiple hematopoietic lineages in addition to osteoclast lineage, OSTM1-defect patients display the most severe recessive osteopetrotic phenotype and die at early ages. Furthermore, it is suggested that OSTM1 has a primary role in neural development not related to lysosomal dysfunction. The canonical Wnt/beta-catenin signaling pathway may be a molecular basis for OSTM1 mutations and severe autosomal recessive osteopetrosis (ARO).

References

1. Chalhoub, N. et al., 2003, Nat Med. 9 (4): 399-406.

2. Quarello, P. et al., 2004, J Bone Miner Res. 19 (7): 1194-1199.

3. Lange, PF. et al., 2006, Nature. 440 (7081): 220-223

4. Maranda, B. et al., 2008, J Bone Miner Res. 23 (2): 296-300.

5. Feigin, ME.et al., 2008, Cell Signal. 20 (5): 949-957.

6. Pata, M.et al., 2008, J Biol Chem. 283 (45): 30522-30530.

Catalog Number:MGF542-NM