Rat Osteoprotegerin/TNFRSF11B Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGF540-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1206bp
Gene Synonym
Opg, MGC93568, Tnfrsf11b
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 11b Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Osteoprotegerin or TNFRSF11B is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. Osteoprotegerin/TNFRSF11B acts as decoy receptor for RANKL and thereby neutralizes its function in osteoclastogenesis. This protein may inhibit the activation of osteoclasts and promotes osteoclast apoptosis in vitro. Bone homeostasis seems to depend on the local RANKL/OPG ratio. Osteoprotegerin/TNFRSF11B also play a role in preventing arterial calcification, act as decoy receptor for TRAIL and protect against apoptosis. TRAIL binding blocks the inhibition of osteoclastogenesis.
References
  • Collin-Osdoby P. (2005) Regulation of vascular calcification by osteoclast regulatory factors RANKL and osteoprotegerin. Circ Res. 95 (11): 1046-57.
  • Boyce BF, et al. (2007) Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res. Ther. 9 Suppl 1: S1.
  • Blázquez-Medela AM, et al. ( 2011) Osteoprotegerin and diabetes-associated pathologies. Curr Mol Med. 11 (5): 401-16.
  • TOP