Mouse Osteomodulin Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_012050.1

RefSeq ORF Size

1272bp

Gene Synonym

OSAD, SLRR2C

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse osteomodulin Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Osteomodulin (OMD), also known as Osteoadherin (OSAD), Keratan sulfate proteoglycan osteomodulin, KSPG osteomodulin, and SLRR2C, is a secreted protein which belongs to the small leucine-rich proteoglycan (SLRP) family and Class II subfamily. SLRP family proteins are normally found in extracellular matrices, but Osteomodulin is the only member restricted to mineralized tissues. Osteomodulin is primarily expressed by osteoblasts and might have a role in regulation of mineralization. In bone OSAD has been localized in primary spongiosa within the bovine fetal rib growth plate. Moreover, in situ hybridization has shown expression of OSAD in osteoblasts close to the cartilage and bone border in the growth plate of rat femur. OSAD may play an important role during tooth development and biomineralization of dentin. Osteomodulin is a cell binding keratan sulfate proteoglycan which was recently isolated from mineralized bovine bone and subsequently cloned and sequenced. Osteomodulin may be implicated in biomineralization processes. It has a function in binding of osteoblasts via the alpha (V) beta (3)-integrin. It is likely that Osteomodulin is an osteoblast maturation marker that is induced by osteoclast activity. Osteomodulin is also an early marker for terminally differentiated matrix producing osteoblasts.

References

Buchaille R, et al. (2000) Expression of the small leucine-rich proteoglycan osteoadherin/osteomodulin in human dental pulp and developing rat teeth. Bone. 27(2): 265-70.

Petersson U, et al. (2003) Identification, distribution and expression of osteoadherin during tooth formation. Eur J Oral Sci. 111(2): 128-36.

Rehn AP, et al. (2006) Differential regulation of osteoadherin (OSAD) by TGF-beta1 and BMP-2. Biochem Biophys Res Commun. 349(3): 1057-64.

Catalog Number:MGF538-CO