Mouse NRN1/Neuritin 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGF388-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
429bp
Gene Synonym
Nrn, Cpg15, 0710008J23Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse neuritin 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Neuritin 1 (NRN1) is a member of neuritin family. Neuritin is a glycosylphosphatidylinositol- anchored protein induced by neural activity. It is expressed in postmitotic-differentiating neurons of the developing nervous system and a population of small-diameter neurons in the dorsal root ganglia and was anterogradely and retrogradely transported. Neuritin message is induced by neuronal activity and by the activity-regulated neurotrophins BDNF, nerve growth factor (NGF) and NT-3. Purified recombinant neuritin promotes neurite outgrowth and arborization in primary embryonic hippocampal and cortical cultures. Thus, neuritin is considered as a downstream effector of activity-induced neurite outgrowth. In clinical, neuritin levels in diabetes were reduced in both dorsal root ganglia and sciatic nerve of rats, and these deficits were reversed in vivo by treatment with NGF. This manipulation of neuritin levels in diabetes may provide a potential target for the therapeutic intervention in the management of neuropathy.
References
  • Karamoysoyli E, et al. (2008) Neuritin mediates nerve growth factor-induced axonal regeneration and is deficient in experimental diabetic neuropathy. Diabetes. 57(1): 181-9.
  • Naeve GS, et al. (1997) Neuritin: A gene induced by neural activity and neurotrophins that promotes neuritogenesis. Proc Natl Acad Sci U S A. 94(6): 2648-2653.
  • Kojima N, et al. (2005) Expression of neuritin during liver maturation and regeneration. FEBS Lett. 579(21): 4562-6.
  • TOP