Rat NPM1/Nucleophosmin Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_012992.4

RefSeq ORF Size

879bp

Gene Synonym

B23NP

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

References

Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.

Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.

Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.

Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.

Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.

Catalog Number:MGF348-CY