Rat Ninjurin-1/NINJ1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGF280-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
459bp
Gene Synonym
Ninj1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ninjurin 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ninjurin-1, also known as NINJ1, is a member of the Ninjurin family of transmembrane (TM) proteins. It is expressed in CD19(+) CD10(+) B-cell progenitor cells and higher levels in B-lineage acute lymphoblastic leukemia cells. Ninjurin-1 is expressed also in a number of other adult and embryonic tissues, predominantly in epithelial cells. Its expression is upregulated after axotomy in neurons and in Schwann cells surrounding the distal nerve segment. Upregulated expression of ninjurin-1 has been identified as a marker of minimal residual disease in B-lineage acute lymphoblastic leukemia. It mediates homophilic adhesion, and promotes neurite extension of dorsal root ganglion neurons in vitro. Ninjurin-1 has been found to show a high expression level in the liver tissue of patients with hepatocellular carcinoma, and this seems to be associated with cases of cirrhosis and chronic viral hepatitis. It has been reported that NINJURIN increases p21 expression and induces cellular senescence in human hepatoma cells.
References
  • Cardoso CC, et al. (2007) Ninjurin 1 asp110ala single nucleotide polymorphism is associated with protection in leprosy nerve damage. J Neuroimmunol. 190 (1-2): 131-8.
  • Ifergan I, et al. (2011) Role of Ninjurin-1 in the migration of myeloid cells to central nervous system inflammatory lesions. Ann Neurol. 70 (5): 751-63.
  • Toyama T, et al. (2005) Ninjurin1 increases p21 expression and induces cellular senescence in human hepatoma cells. J Hepatol. 41 (4): 637-43.
  • TOP