Mouse NETO1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_144946.4

RefSeq ORF Size

1602bp

Gene Synonym

Btcl1, AI851453, C130005O10Rik, Neto1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse neuropilin (NRP) and tolloid (TLL)-like 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Neuropilin tolloid-like 1 (NETO1), a complement C1r/C1s, Uegf, Bmp1 (CUB) domain-containing transmembrane protein, is a novel component of the NMDAR complex critical for maintaining the abundance of NR2A-containing NMDARs in the postsynaptic density. The N-methyl-D-aspartate receptor (NMDAR), a major excitatory ligand-gated ion channel in the central nervous system (CNS), is a principal mediator of synaptic plasticity. Both NETO1 and NETO2 share an identical and unique domain structure thus representing a novel subfamily of CUB- and LDLa-containing proteins. The cytoplasmic domains of NETO1 and NETO2 are not homologous to other known protein sequences but contain a conserved FXNPXY-like motif, which is essential for the internalization of clathrin coated pits during endocytosis or alternatively, may be implicated in intracellular signaling pathways. NETO1 and NETO2, have marked effects on receptor properties, increasing further the potential diversity of Kainate receptors (KARs) functional properties. NETO1 involves in the development and/or maintenance of neuronal circuitry. NETO1 regulates long-term NMDA receptor-dependent synaptic plasticity and cognition, at least in the context of spatial learning and memory.

References

Sthr H, et al. (2002) A novel gene encoding a putative transmembrane protein with two extracellular CUB domains and a low-density lipoprotein class A module: isolation of alternatively spliced isoforms in retina and brain. Gene. 286(2): 223-31.

Ng D, et al.d for synaptic plasticity and learning. PLoS Biol. 7(2): e41.

Perrais D, et al. (2010) Gating and permeation of kainate receptors: differences unveiled. Trends Pharmacol Sci. 31(11): 516-22.

Catalog Number:MGF237-NF