Mouse NBL1/DAND1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_008675.2

RefSeq ORF Size

537bp

Gene Synonym

DAN, NO3, Dana, MGC123430, D4H1S1733E, Nbl1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse neuroblastoma, suppression of tumorigenicity 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The Dan (Differential screening-selected gene aberrative in neuroblastoma, also known as N03) gene was first identified as the putative rat tumor suppressor gene and encodes a protein structurally related to Cerberus and Gremlin in vertebrates. It is a founding member of the DAN family of secreted proteins, acts as an inhibitor of cell cycle progression and is closely involved in retinoic acid-induced neuroblastoma differentiation. There are at least five mammalian protein members in the evolutionarily conserved Dan family including DAN, Gremlin/DRM, Cer1 (Cerberus-related), Dante and PRDC (protein related to DAN and cereberus), and share the C-terminal cystine-knot motif. As a secreted glycoprotein, DAN is a member of a class of glycoproteins shown to be secreted inhibitors of the transforming growth factor-beta (TGF-beta) and bone morphogenic protein pathways. It binds to BMPs and preventing their interactions with signaling receptor complexes, and accordingly regulates the processes of embryonic development and tissue differentiation. DAN gene product may have an important role in regulation of the entry of cells into the S phase. In addition, DAN gene product possesses an ability to revert phenotypes of transformed rat fibroblasts and represents a candidate tumour suppressor gene for neuroblastoma.

References

Ozaki T, et al. (1995) Overexpression of DAN gene product in normal rat fibroblasts causes a retardation of the entry into the S phase. Cancer Res. 55(4): 895-900.

Nakamura Y, et al. (1997) A product of DAN, a novel candidate tumour suppressor gene, is secreted into culture medium and suppresses DNA synthesis. Eur J Cancer. 33(12): 1986-90.

Ogita J, et al. (2001) Expression of the Dan gene during chicken embryonic development. Mech Dev. 109(2): 363-5.

Kim AS, et al. (2003) Expression of the BMP antagonist Dan during murine forebrain development. Brain Res Dev Brain Res. 145(1): 159-62.

Catalog Number:MGF147-CY