Rat NAP-2 / PPBP / CXCL7 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGF132-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
336bp
Gene Synonym
Cxcl7, Nap-2, Ppbp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Pro-platelet basic protein (PPBP) is also known as Chemokine (C-X-C motif) ligand 7 (CXCL7) and nucleosome assembly protein (Nap-2). Nap-2 / PPBP / CXCL7 is released in large amounts from platelets following their activation and is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. Nap-2 / PPBP / CXCL7 has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. Nap-2 is a ligand for CXCR1 and CXCR2, and Nap-2, Nap-2 (73), Nap-2 (74), Nap-2 (1-66), and most potent Nap-2 (1-63) are chemoattractants and activators for neutrophils.
References
  • Walz A, et al. (1989) Effects of the neutrophil-activating peptide NAP-2, platelet basic protein, connective tissue-activating peptide III and platelet factor 4 on human neutrophils. J Exp Med. 170(5):1745-50.
  • Walz A, et al. (1990) Generation of the neutrophil-activating peptide NAP-2 from platelet basic protein or connective tissue-activating peptide III through monocyte proteases. J Exp Med. 171(2): 449-54.
  • Loetscher P, et al. (1994) Both interleukin-8 receptors independently mediate chemotaxis. Jurkat cells transfected with IL-8R1 or IL-8R2 migrate in response to IL-8, GRO alpha and NAP-2. FEBS Lett. 341(2-3): 187-92.
  • TOP