Mouse Myelin oligodendrocyte glycoprotein Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGF090-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
744bp
Gene Synonym
B230317G11Rik, Mog
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse myelin oligodendrocyte glycoprotein Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Myelin oligodendrocyte glycoprotein (MOG) is a transmembrane protein belonging to immunoglobulin superfamily, and contains an Ig-like domain followed by two potential membrane-spanning regions. MOG is expressed only in the CNS with very low content (approximately 0.1% total proteins) in oligodendrogliocyte membrane. Three possible functions for MOG were suggested: (a) a cellular adhesive molecule, (b) a regulator of oligodendrocyte microtubule stability, and (c) a mediator of interactions between myelin and the immune system, in particular, the complement cascade. A direct interaction might exist between the membrane-associated regions of MOG and the myelin-specific glycolipid galactocerebroside (Gal-C), and such an interaction may have important consequences regarding the membrane topology and function of both molecules. It is considered that MOG is an autoantigen capable to produce a demyelinating multiple sclerosis-like disease in experimental animals.
References
  • Chekhonin VP, et al. (2003) Myelin oligodendrogliocyte glycoprotein: the structure, functions, role in pathogenesis of demyelinating disorders. Biomed Khim. 49(5): 411-23.
  • Hilton AA, et al. (1995) Characterization of cDNA and Genomic Clones Encoding Human Myelin Oligodendrocyte Glycoprotein. J Neurochem. 65(1): 309-18.
  • Johns TG, et al. (1999) The Structure and Function of Myelin Oligodendrocyte Glycoprotein. J Neurochem. 72(1): 1-9.
  • TOP