Mouse MUC1/Mucin 1/CD227 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGF066-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1929 bp
Gene Synonym
EMA, CD227, Muc-1, Muc1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse mucin 1, transmembrane Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
HindIII + XbaI(6kb+1.93kb)
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Mucin 1, cell surface associated (MUC1) or polymorphic epithelial mucin (PEM) is a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. MUC-1/CC1/CD227 Exclusively located in the apical domain of the plasma membrane of highly polarized epithelial cells. After endocytosis, internalized and recycled to the cell membrane. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. The alpha subunit has cell adhesive properties. MUC-1/CC1/CD227 Can act both as an adhesion and an anti-adhesion protein. This protein May provide a protective layer on epithelial cells against bacterial and enzyme attack. The beta subunit contains a C-terminal domain which is involved in cell signaling, through phosphorylations and protein-protein interactions. MUC-1/CC1/CD227 participated in modulates signaling in ERK, SRC and NF-kappa-B pathways. In activated T-cells, MUC-1/CC1/CD227 influences directly or indirectly the Ras/MAPK pathway. MUC-1/CC1/CD227 Promotes tumor progression and regulates TP53-mediated transcription and determines cell fate in the genotoxic stress response. Binds, together with KLF4, the PE21 promoter element of TP53 and represses TP53 activity.
References
  • Brayman M, et al. (2004) MUC1: a multifunctional cell surface component of reproductive tissue epithelia. Reprod Biol Endocrinol 2: 4.
  • Schroeder J A, et al. (2001) Transgenic MUC1 interacts with epidermal growth factor receptor and correlates with mitogen-activated protein kinase activation in the mouse mammary gland. J Biol Chem. 276 (16): 13057-64.
  • Li Y, et al. (2001) The epidermal growth factor receptor regulates interaction of the human DF3/MUC1 carcinoma antigen with c-Src and beta-catenin. J Biol Chem. 276 (38): 35239-42.
  • TOP