Mouse MMP-7/MMP7 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGE897-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
804bp
Gene Synonym
MAT, Mmp7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse matrix metallopeptidase 7 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological and pathological processes such as morphogenesis, differentiation, angiogenesis, tissue remodeling, and tumor invasion. MMPs are synthesized as pro-enzymes and converted to active form by extracellular proteinases. MMP7, also referred to as matrilysin, is the smallest member of the MMP family and differs from other MMP members in that it lacks the C-terminal hemopexin-like domain. MMP7 is produced primarily by mucosal epithelia, and is capable of degrading various ECM proteins including proteoglycans, fibronectin, elastin and casein. This enzyme serves essential functions in both innate defense and wound healing, and appears to be one of the most important MMPs in human colon cancers. It has been reported that MMP7 contributes to tumor malignancy probably by cleaving cell surface proteins such as Fas ligand, degradation of IgG or inducing E-cadherin-mediated cell aggregation. In addition, matrilysin is also identified as a mediator of pulmonary fibrosis and a potential therapeutic target.
References
TOP