Human MERTK/Mer Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_006343.2

RefSeq ORF Size

3000bp

Gene Synonym

MERTK, MER, RP38, c-mer, MGC133349

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human c-mer proto-oncogene tyrosine kinase Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

&Proto-oncogene tyrosine-protein kinase MER (MERTK) is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. MERTK is localized in membrane and is no expressed in normal B- and T-lymphocytes but is expressed in numerous neoplastic B- and T-cell lines. This protein is highly expressed in testis, ovary, prostate, lung, and kidney, with lower expression in spleen, small intestine, colon, and liver. MERTK regulates many physiological processes including cell survival, migration, differentiation, and phagocytosis of apoptotic cells (efferocytosis). Ligand binding at the cell surface induces autophosphorylation of MERTK on its intracellular domain that provides docking sites for downstream signaling molecules. MERTK signaling plays a role in various processes such as macrophage clearance of apoptotic cells, platelet aggregation, cytoskeleton reorganization and engulfment. MERTK plays also an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response by activating STAT1, which selectively induces production of suppressors of cytokine signaling SOCS1 and SOCS3. Defects in MERTK are the cause of retinitis pigmentosa type 38.

References

Thompson DA, et al. (2002) Retinal dystrophy due to paternal isodisomy for chromosome 1 or chromosome 2, with homoallelism for mutations in RPE65 or MERTK, respectively. Am J Hum Genet. 70 (1): 224-9.

Tada A, et al. (2006) Screening of the MERTK gene for mutations in Japanese patients with autosomal recessive retinitis pigmentosa. Mol Vis. 12: 441-4.

McHenry CL, et al. (2004) MERTK arginine-844-cysteine in a patient with severe rod-cone dystrophy: loss of mutant protein function in transfected cells. Invest Ophthalmol. Vis Sci. 45 (5): 1456-63.

Catalog Number:MGE791-NO