Human MEP1A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_005588.2

RefSeq ORF Size

2241bp

Gene Synonym

PPHA

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human meprin A, alpha (PABA peptide hydrolase) Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Meprin A subunit alpha, also known as MEP1A, and Endopeptidase-2, is a single-pass type I membrane protein which belongs to the peptidase M12A family. MEP1A contains one EGF-like domain, one MAM domain, and one MATH domain. Meprins are unique plasma membrane and secreted metalloproteinases that are highly regulated at the transcriptional and post-translational levels. Meprin alpha and beta subunits are abundantly expressed in kidney and intestinal epithelial cells, are secreted into the urinary tract and intestinal lumen, and are found in leukocytes and cancer cells under certain conditions. Meprins are capable of proteolytically degrading extracellular matrix proteins, proteolytically processing bioactive proteins, and play a role in inflammatory processes. Meprin A and B are highly regulated, secreted and cell-surface homo- and hetero-oligomeric enzymes. Meprins are abundantly expressed in kidney and intestine. The multidomain alpha and beta subunits have high sequence identity. They have very different substrate specificities, oligomerization potentials and are differentially regulated. Meprin A appears to be an important therapeutic target and urinary excretion appears to be a potential biomarker of acute kidney injury ( AKI ).

References

Bertenshaw,GP. et al., 2002, Biol Chem. 383 (7-8):1175-83.

Bond, JS. et al., 2005, FEBS Lett. 579 (15): 3317-22.

Herzog, C. et al., 2007, Kidney Int. 71 (10): 1009-18.

Yura, RE. et al., 2009, Am J Physiol Renal Physiol. 296 (1): F135-44.

Catalog Number:MGE782-CM