Mouse MEK1/MAP2K1/MKK1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGE777-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1182bp
Gene Synonym
Mek1, MEKK1, MAPKK1, Prkmk1, Map2k1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
MEK1, also known as MAP2K1 and MKK1, is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. MEK1 is widely expressed, with extremely low levels in brain. It lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, MEK1 is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. Binding extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation. RAF1 then further activates the dual-specificity protein kinases MAP2K1 and MEK2. MEK1 has been shown to export PPARG from the nucleus. The MAPK cascade is also involved in the regulation of endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC), as well as in the fragmentation of the Golgi apparatus during mitosis. MKK1 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. Defects in MEK1 can cause cardiofaciocutaneous syndrome.
References
  • Rampoldi L, et al. (1998) Chromosomal localization of four MAPK signaling cascade genes: MEK1, MEK3, MEK4 and MEKK5. Cytogenet Cell Genet. 78(3-4):301-3.
  • Zheng CF, et al. (1993) Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J Biol Chem. 268(15):11435-9.
  • Nantel, et al. (1998) Interaction of the Grb10 adapter protein with the Raf1 and MEK1 kinases. J Biol Chem. 273(17):10475-84.
  • Hirata H, et al. (2012) I MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer. Carcinogenesis. 33(1):41-8.
  • TOP