Mouse MCPT1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGE736-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
675bp
Gene Synonym
Mcp-1, AV080368, Mcpt1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse mast cell protease 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Mast Cell Protease 1 (MMCP-1), also known as MCP-1, MCPT-1 and β-chymase, is a member of the Chymase family of chymotrypsin-like serine proteases. MCPT-1 is a 26 kDa β-chymase that is a component of mast cell granules. It is a 226 amino acid (aa) protein that has a conserved pattern of six cysteines and one potential glycosylation site. The granule-derived mouse mast cell proteases-1 and -2 (mMCP-1 and -2) colocalize in similar quantities in mucosal mast cells but micrograms of mMCP-1 compared with nanograms of mMCP-2 are detected in peripheral blood during intestinal nematode infection. mMCP-1 isolated from serum is complexed with serpins and both the accumulation and the longevity of mMCP-1 in blood is due to complex formation, protecting it from a pathway that rapidly clears mMCP-2, which is unable to form complexes with serpins. The mucosal mast cell (MMC) granule-specific beta-chymase, mouse mast cell protease-1 (mMCP-1), is released systemically into the bloodstream early in nematode infection before parasite-specific IgE responses develop and TGF-beta1 induces constitutive release of mMCP-1 by homologues of MMC in vitro. Expression of mMCP-1 is largely restricted to intraepithelial MMC and is thought to play a role in the regulation of epithelial permeability. Its activation is completed by the removal of a two residue N-terminal propeptide by a dipeptidyl peptidase (Cathepsin C). MCPT-1 is upregulated in the intestine in response to nematode infection, or in systemic mucosa in response to anaphylaxis. Like human α-chymase, MCPT-1 is capable of the conversion of angiotensin I to angiotensin II, which plays a key role in the regulation of arterial pressure. The intestinal inflammation associated with gastrointestinal helminths is partly mediated by mMCP-1.
References
  • Pemberton AD, et al. (2003) Purification and characterization of mouse mast cell proteinase-2 and the differential expression and release of mouse mast cell proteinase-1 and -2 in vivo. Clin Exp Allergy. 33(7): 1005-12.
  • Brown JK, et al. (2003) Constitutive secretion of the granule chymase mouse mast cell protease-1 and the chemokine, CCL2, by mucosal mast cell homologues. Clin Exp Allergy. 33(1): 132-46.
  • Lawrence CE, et al. (2004) Mouse mast cell protease-1 is required for the enteropathy induced by gastrointestinal helminth infection in the mouse. Gastroenterology. 127(1): 155-65.
  • Pemberton AD, et al. (2006) Anaphylactic release of mucosal mast cell granule proteases: role of serpins in the differential clearance of mouse mast cell proteases-1 and -2. J Immunol. 176(2): 899-904.
  • TOP