Mouse MAPT / PHF-tau Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGE687-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1119bp
Gene Synonym
Tau; Mtapt; AI413597; AW045860
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse microtubule-associated protein tau Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
MAPT (microtubule-associated protein tau) can produce tau proteins. Tau proteins are proteins that stabilize microtubules. They are abundant in neurons of the central nervous system and are less common elsewhere, but are also expressed at very low levels in CNS astrocytes and oligodendrocytes. When tau proteins are defective, and no longer stabilize microtubules properly, they can result in dementias such as Alzheimer's disease. Tau protein is a highly soluble microtubule-associated protein (MAP). In humans, these proteins are mostly found in neurons compared to non-neuronal cells. One of tau's main functions is to modulate the stability of axonal microtubules. Other nervous system MAPs may perform similar functions, as suggested by tau knockout mice, who did not show abnormalities in brain development - possibly because of compensation in tau deficiency by other MAPs.
References
  • Harada A, et al. (1994) Altered microtubule organization in small-calibre axons of mice lacking tau protein. Nature. 369(6480):488-91.
  • Weingarten MD, et al. (1975) A protein factor essential for microtubule assembly. Proc Natl Acad Sci. 72(5):1858-62.
  • Goedert M, et al. (1989) Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer's disease. Neuron. 3(4): 519-26.
  • TOP