Mouse MANF Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGE663-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
540bp
Gene Synonym
Armet, D17914, AA407711, AA408789, AA673178, D18Mgi17, 3230402M22Rik, Manf
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse mesencephalic astrocyte-derived neurotrophic factor Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Mesencephalic astrocyte-derived neurotrophic factor, also known as Protein ARMET, Arginine-rich protein, MANF and ARMET, is a secreted protein which belongs to the ARMET family. ARMET selectively promotes the survival of dopaminergic neurons of the ventral mid-brain. It modulates GABAergic transmission to the dopaminergic neurons of the substantia nigra. ARMET enhances spontaneous, as well as evoked, GABAergic inhibitory postsynaptic currents in dopaminergic neurons. ARMET inhibits cell proliferation and endoplasmic reticulum (ER) stress-induced cell death. The N-terminal region of ARMET may be responsible for neurotrophic activity while the C-terminal region may play a role in the ER stress response. MANF reduces endoplasmic reticulum (ER) stress and has neurotrophic effects on dopaminergic neurons. Intracortical delivery of recombinant MANF protein protects tissue from ischemic brain injury. MANF has been described as a survival factor for dopaminergic neurons. MANF expression was widespread in the nervous system and non-neuronal tissues. In the brain, relatively high MANF levels were detected in the cerebral cortex, hippocampus and cerebellar Purkinje cells. The widespread expression of MANF together with its evolutionary conserved nature and regulation by brain insults suggest that it has important functions both under normal and pathological conditions in many tissue types.
References
  • Shridhar V., et al., 1996, Oncogene 12:1931-1939.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Petrova P., et al., 2003, J. Mol. Neurosci. 20:173-188.
  • Lindholm, P. et al., 2008, Mol Cell Neurosci. 39 (3):356-71.
  • Airavaara, M. et al., 2010, Exp Neurol. 225 (1):104-13.
  • TOP