Human Lumican Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGE589-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1017bp
Gene Synonym
LDC, SLRR2D, LUM
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lumican Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
KpnI + NotI (6kb + 1.06kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lumican, a prototypic leucine-rich proteoglycan with keratan sulfate side chains, is a major component of the cornea, dermal, and muscle connective tissues. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican regulates collagenous matrix assembly as a keratan sulfate proteoglycan in the cornea and is also present in the connective tissues of other organs and embryonic corneal stroma as a glycoprotein. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. lumican expressed in injured epithelium may modulate cell behavior such as adhesion or migration, thus contributing to corneal epithelial wound healing. Lumican plays a crucial role in the regulation of collagen assembly into fibrils in various connective tissues and serve as a definitive link between a necessity for lumican in the development of a highly organized collagenous matrix and corneal transparency.
References
  • Saika S, et al. (2000) Role of lumican in the corneal epithelium during wound healing. J Biol Chem. 275(4): 2607-12.
  • Chakravarti S, et al. (1998) Lumican regulates collagen fibril assembly: skin fragility and corneal opacity in the absence of lumican. J Cell Biol. 141(5): 1277-86.
  • Ezura Y, et al. (2000) Differential expression of lumican and fibromodulin regulate collagen fibrillogenesis in developing mouse tendons. J Cell Biol. 151(4): 779-88.
  • TOP