Human LSD1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGE568-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2559bp
Gene Synonym
AOF2; KDM1; LSD1; BHC110
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lysine (K)-specific demethylase 1A Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
LSD1 belongs to the flavin monoamine oxidase family. It contains 1 SWIRM domain and is a component of a RCOR/GFI/LSD1/HDAC complex. LSD1 interacts directly with GFI1 and GFI1B. LSD1 speficially removes histone H3K4me2 to H3K4me1 or H3K4me0 through a FAD-dependent oxidative reaction. When forming a complex with androgen receptor (and possibly other nuclear hormone receptors), LSD1 changes its substrates to H3K9me2. Thus LSD1 is considered to act as a coactivator or a corepressor. It may play a role in the repression of neuronal genes. Alone, LSD1 is unable to demethylate H3 'Lys-4' on nucleosomes and requires the presence of RCOR1/CoREST to achieve such activity.
References
  • Kusaba M, et al. (2007) Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell. 19(4):1362-75.
  • Pazour GJ, et al. (2005) Proteomic analysis of a eukaryotic cilium. J Cell Biol. 170(1):103-13.
  • Merchant SS, et al. (2007) The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 318(5848):245-50.
  • TOP