Mouse LILRB3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGE366-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2526bp
Gene Synonym
Gp91, Pirb, Lilrb3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Leukocyte immunoglobulin-like receptor subfamily B member 3, also known as Leukocyte immunoglobulin-like receptor 3, Immunoglobulin-like transcript 5, Monocyte inhibitory receptor HL9, CD85 antigen-like family member A, CD85a and LILRB3, is a single-pass type I  membrane protein which belongs to the leukocyte receptor cluster (LRC) present on 19q13.4. LILRB3 / CD85a contains four Ig-like C2-type (immunoglobulin-like) domains. LILRB3 / CD85a contains three copies of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases. LILRB3 / CD85a is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found.
References
  • Huang,J. et al., 2010, J Virol. 84 (18): 9463-71.
  • Arm J.P. et al., 1997, J. Immunol. 159:2342-2349.
  • Wende H. et al., 2000, Immunogenetics 51:703-713.
  • Yu L.-R. et al., 2007,J. Proteome Res. 6:4150-4162.
  • TOP