Mouse LGALS7 / Galectin-7 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGE345-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
411bp
Gene Synonym
MGC151215, MGC151217, Galectin-7, Lgals7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse lectin, galactose binding, soluble 7 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
LGALS7, also known as Galectin-7, is a member of the galectins family. The galectins are a family of beta-galactoside-binding proteins. There are at least 14 identified members in this family. Galectins share similarities in the CRD (the carbohydrate recognition domain). They are synthesized as cytosolic proteins. Though localized principally in the cytoplasm and lacking a classical signal peptide, galectins can also be stimulated to secretion by non-classical pathways or alternatively targeted to the nucleus. Galectins are implicated in modulating cell-cell and cell-matrix interactions. LGALS7 contains 1 galectin domain and is mainly expressed in stratified squamous epithelium. Galectin-7 could be involved in cell-cell and/or cell-matrix interactions necessary for normal growth control. LGALS7 is a pro-apoptotic protein that functions intracellularly upstream of JNK activation and cytochrome c release.
References
  • Villeneuve C, et al. (2011) Mitochondrial proteomic approach reveals galectin-7 as a novel BCL-2 binding protein in human cells. Mol Biol Cell. 22(7):999-1013.
  • Rondanino C, et al. (2011) Galectin-7 modulates the length of the primary cilia and wound repair in polarized kidney epithelial cells. Am J Physiol Renal Physiol. 301(3):F622-33.
  • Masuyer G, et al. (2012) Inhibition mechanism of human galectin-7 by a novel galactose-benzylphosphate inhibitor. FEBS J. 279(2):193-202.
  • Magnaldo T, et al. (1995) Galectin-7, a human 14-kDa S-lectin, specifically expressed in keratinocytes and sensitive to retinoic acid. Dev Biol. 168(2):259-71.
  • Madsen P, et al. (1995) Cloning, expression, and chromosome mapping of human galectin-7. J Biol Chem. 270(11):5823-29.
  • TOP