Human Leukotriene A4 Hydrolase/LTA4H Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGE339-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1836bp
Gene Synonym
LTA4H
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human leukotriene A4 hydrolase Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Leukotriene A-4 hydrolase, also known as LTA-4 hydrolase, Leukotriene A (4) hydrolase, LTA4H and LTA4, is cytoplasm protein which belongs to the peptidase M1 family. LTA4H hydrolyzes an epoxide moiety of leukotriene A4 (LTA-4) to form leukotriene B4 (LTB-4). This enzyme also has some peptidase activity. The leukotrienes (LTs) are a class of structurally related lipid mediators involved in the development and maintenance of inflammatory and allergic reactions. In the biosynthesis of LTs, arachidonic acid was converted into the unstable intermediate epoxide LTA4, which may in turn be conjugated with glutathione to form the spasmogenic LTC4, or hydrolyzed into the proinflammatory lipid mediator LTB4 in a reaction catalyzed by Leukotriene A4 hydrolase (LTA4H). LTB4 is a classical chemoattractant of human neutrophils and triggers adherence and aggregation of leukocytes to vascular endothelium, and also modulates immune responses. As a bifunctional zinc metalloenzyme, LTA4H also exhibits an anion-dependant arginyl aminopeptidase activity of high efficiency and specificity in addition to its epoxide hydrolase activity. LTA4H is regarded as a therapeutic target for inflammation.
References
  • Mancini, JA. et al.,1995, Eur. J. Biochem. 231: 65-71.
  • Orning, L. et al., 1994, J. Biol. Chem. 269: 11269-73.
  • Rudberg, PC. et al., 2004, J. Biol. Chem. 279: 27376-82.
  • Qiu, H. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 8161-6.
  • TOP