Mouse Leukemia Inhibitory Factor/LIF transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGE338-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
477bp
Gene Synonym
Lif
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse leukemia inhibitory factor, transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Leukemia inhibitory factor (LIF) is a pleiotropic glycoprotein belonging to the IL-6 family of cytokines. It’s involved in growth promotion and cell differentiation of different types of target cells, influence on bone metabolism, cachexia, neural development, embryogenesis and inflammation. LIF has potent proinflammatory property, being the inducer of the acute phase protein synthesis and affecting the cell recruitment into the area of damage or inflammation. LIF is also one of the cytokines that are capable to regulate the differentiation of embryonic stem cells, hematopoietic and neuronal cells. LIF binds to the specific LIF receptor (LIFR-α) which forms a heterodimer with a specific subunit common to all members of that family of receptors, the GP130 signal transducing subunit. This leads to activation of the JAK/STAT and MAPK cascades. Due to its polyfunctional activities, LIF is involved in the pathogenic events and development of many diseases of various origin.
References
  • Salas EM, et al. (2011) LIF, a Novel STAT5-Regulated Gene, Is Aberrantly Expressed in Myeloproliferative Neoplasms. Genes Cancer. 2 (5): 593-6.
  • Chodorowska G, et al. (2004) Leukemia inhibitory factor (LIF) and its biological activity. Ann Univ Mariae Curie Sklodowska Med. 59 (2): 189-93.
  • Garcia-Campana AM, et al. (2007) LIF detection of peptides and proteins in CE. Electrophoresis. 28 (1-2): 208-32.
  • TOP