Rat Legumain Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_022226.2

RefSeq ORF Size

1308bp

Gene Synonym

Prsc1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat legumain Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The Mammalian Legumain, also known as LGMN, also called asparaginyl endopeptidase (AEP), is a cysteine protease belonging to peptidase family C13 with a strict specificity for hydrolysis of asparaginyl bonds. Known previously only from plants and invertebrates, Legumain is discovered as a lysosomal endopeptidase in mammals. Mammalian Legumain is a cysteine endopeptidase, inhibited by iodoacetamide and maleimides, but unaffected by compound E64. The Mammalian Legumain is involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Legumain has been observed to be highly expressed in several types of solid tumors. It was demonstrated in membrane-associated vesicles concentrated at the invadopodia of tumor cells and on cell surfaces where it colocalized with integrins. Legumain was demonstrated to activate progelatinase A. Cells overexpressing Legumain possessed increased migratory and invasive activity in vitro and adopted an invasive and metastatic phenotype in vivo, inferring significance of Legumain in tumor invasion and metastasis. In addition, Legumain is expressed in both murine and human atherosclerotic lesions. The macrophage-specific expression of Legumain in vivo and ability of Legumain to induce chemotaxis of monocytes and endothelial cells in vitro suggest that Legumain may play a functional role in atherogenesis.

References

Schwarz G, et al. (2002) Characterization of legumain. Biol Chem. 383(11): 1813-6.

Liu C, et al. (2003) Overexpression of legumain in tumors is significant for invasion/metastasis and a candidate enzymatic target for prodrug therapy. Cancer Res. 63(11): 2957-64.

Murthy RV, et al. (2005) Legumain expression in relation to clinicopathologic and biological variables in colorectal cancer. Clin Cancer Res. 11(6): 2293-9.

Gawenda J, et al. (2007) Legumain expression as a prognostic factor in breast cancer patients. Breast Cancer Res Treat. 102(1): 1-6.

Clerin V, et al. (2007) Expression of the cysteine protease legumain in vascular lesions and functional implications in atherogenesis. Atherosclerosis. 201(1): 53-66.

Lew?“n S, et al. (2008) A Legumain-based minigene vaccine targets the tumor stroma and suppresses breast cancer growth and angiogenesis. Cancer Immunol Immunother. 57(4): 507-15.

Catalog Number:MGE329-CM