Human Lck Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:MGE304-CG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1530bp
Gene Synonym
LCK, YT16, p56lck, pp58lck
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lymphocyte-specific proteintyrosine kinase (LCK), transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein kinases are critically involved in signaling pathways that regulate cell growth, differentiation, activation, and survival. Initially identified as a T-cell specific member of the Src family of protein tyrosine kinases, Lck has become the object of intensive investigations which have revealed a key role for this kinase in the central processes controlling T-cell development, activation, proliferation and survival. Lck is expressed specifically in lymphoid cells. It contains one protein kinase domain, one SH2 domain, and one SH3 domain. It is associated with a variety of cell surface receptors and is critical for signal transduction from the T-cell antigen receptor (TCR). Consequently, Lck is targeted by regulatory proteins of T-lymphotropic viruses, especially by the Herpesvirus saimiri (HVS) tyrosine kinase interacting protein (Tip). This oncoprotein physically interacts with Lck in HVS transformed T cells and has an impact on its catalytic activity. Together with the identification of defects in the regulation of Lck expression or activity in T-cell leukemias, suggests that dysregulation of Lck might play a role in neoplastic transformation. However, under certain conditions Lck is also involved in the induction of apoptosis. This chemosensitizing effect of Lck is independent of T-cell receptor signaling and does not require the kinase activity of Lck. The findings demonstrate that Lck might be part of two independent signaling pathways leading to either cell proliferation or apoptosis.
References
  • Majolini MB, et al. (1999) Dysregulation of the protein tyrosine kinase LCK in lymphoproliferative disorders and in other neoplasias. Leuk Lymphoma. 35(3-4): 245-54.
  • Isakov N, et al. (2000) Lck protein tyrosine kinase is a key regulator of T-cell activation and a target for signal intervention by Herpesvirus saimiri and other viral gene products. Eur J Biochem. 267(12): 3413-21.
  • Heyninck K, et al. (2006) A novel link between Lck, Bak expression and chemosensitivity. Oncogene. 25(12): 1693-5.
  • TOP