Mouse Lactotransferrin/LTF Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGE268-NG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2124bp
Gene Synonym
Lf, Csp82, Ms10r, MMS10R, Ltf
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse lactotransferrin Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lactotransferrin, also known as Lactoferrin, Talalactoferrin and LTF, is a secreted protein which belongs to the transferrin family. Transferrins are iron binding transport proteins which can bind two Fe3+ ions in association with the binding of an anion, usually bicarbonate. Lactotransferrin has antimicrobial activity which depends on the extracellular cation concentration. Lactoferroxins A, B and C have opioid antagonist activity. Lactoferroxin A shows preference for mu-receptors, while lactoferroxin B and lactoferroxin C have somewhat higher degrees of preference for kappa-receptors than for mu-receptors. Lactoferrin / LTF is a globular glycoprotein that is widely represented in various secretory fluids, such as milk, saliva, tears, and nasal secretions. Lactoferrin / LTF is also present in secondary granules of PMN and is secreted by some acinar cells. Lactoferrin / LTF can be purified from milk or produced recombinantly. Human colostrum has the highest concentration, followed by human milk, then cow milk. Lactoferrin / LTF is one of the components of the immune system of the body; it has antimicrobial activity (bacteriocide, fungicide) and is part of the innate defense, mainly at mucoses. In particular, lactoferrin provides antibacterial activity to human infants. Lactoferrin interacts with DNA and RNA, polysaccharides and heparin, and shows some of its biological functions in complexes with these ligands.
References
  • Sánchez L, et al.,1992, Arch. Dis. Child. 67 (5): 657 - 61.
  • Wakabayashi H, et al., 2000, J. Antimicrob. Chemother. 46 (4): 595-602.
  • Nozaki A, et al., 2003, J. Biol. Chem. 278 (12): 10162-73.
  • Azzam HS, et al., 2007, Liver Int. 27 (1): 17-25.
  • TOP