Mouse Klrb1a Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010737.3

RefSeq ORF Size

702bp

Gene Synonym

Ly55a, NKRP12, Nkrp1a, NKR-P1A, Nkrp1-a, Klrb1a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse killer cell lectin-like receptor subfamily B member 1A Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

References

Plougastel B, et al. (2001) Analysis of a 1-Mb BAC contig overlapping the mouse Nkrp1 cluster of genes: cloning of three new Nkrp1 members, Nkrp1d, Nkrp1e, and Nkrp1f. Immunogenetics 53: 592-598.

Kogelberg H, et al. (2000) Expression in Escherichia coli, folding in vitro, and characterization of the carbohydrate recognition domain of the natural killer cell receptor NKR-P1A. Protein Expr Purif. 20(1): 10-20.

Grazia Cifone M, et al. (1997) NKR-P1A stimulation of arachidonate-generating enzymes in rat NK cells is associated with granule release and cytotoxic activity. J Immunol. 159(1): 309-17.

Josien R, et al. (1997) Rat spleen dendritic cells express natural killer cell receptor protein 1 (NKR-P1) and have cytotoxic activity to select targets via a Ca2+-dependent mechanism. J Exp Med. 186: 467-472.

Ryan JC, et al. (1995) NKR-P1A is a target-specific receptor that activates natural killer cell cytotoxicity. J Exp Med. 181(5): 1911-5.

Lanier L L, et al. (1994) Human NKR-P1A: a disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol. 153: 2417-2428.

Chambers W, et al. (1989) Monoclonal antibody to a triggering structure expressed on rat natural killer cells and adherent lymphokine-activated killer cells. J Exp Med. 169: 1373-1389.

Catalog Number:MGE208-NO