Mouse KLK8/Kallikrein 8 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGE205-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
783bp
Gene Synonym
BSP1, Nrpn, Prss19, Klk8
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse kallikrein related-peptidase 8 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Kallikrein-8, also known as Neuropsin, Serine protease 19, Serine protease TADG-14, Tumor-associated differentially expressed gene 14 protein and KLK8, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. It is a serine protease which is capable of degrading a number of proteins such as casein, fibrinogen, kininogen, fibronectin and collagen type IV. Kallikrein-8 / KLK8 plays a role in the formation and maturation of orphan and small synaptic boutons in the Schaffer-collateral pathway. It regulates Schaffer-collateral long-term potentiation in the hippocampus and is required for memory acquisition and synaptic plasticity. It is involved in skin desquamation and keratinocyte proliferation and plays a role in the secondary phase of pathogenesis following spinal cord injury. It also cleaves L1CAM in response to increased neural activity. It induces neurite outgrowth and fasciculation of cultured hippocampal neurons. Kallikrein-8 / KLK8 is expressed at high levels in serum, ascites fluid and tumor cytosol of advanced stage ovarian cancer patients and may serve as a marker of ovarian cancer. Kallikrein-8 / KLK8 may have potential clinical value for disease diagnosis or prognosis and it may also be a useful therapeutic target.
References
TOP