Mouse KLK7/Kallikrein 7(PRSS6) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011872.2

RefSeq ORF Size

750bp

Gene Synonym

SCCE, Prss6, Klk7

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse kallikrein related-peptidase 7 (chymotryptic, stratum corneum) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Kallikrein-7, also known as kallikrein-related peptidase 7, Stratum corneum chymotryptic enzyme, Serine protease 6, KLK7, and PRSS6, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Members of the Kallikrein family are involved in various malignancies such as prostate (PSA, KLK2, KLK15), ovarian (KLK4, KLK5, KLK6, KLK8, KLK10), and breast cancer (KLK10, KLK13, KLK14). Kallikrein-7 / KLK7 appears to be increased in ovarian cancer and higher KLK7 expression in ovarian cancer tissue is associated with poorer prognosis of ovarian cancer patients. Kallikrein-7 / KLK7 is abundantly expressed in the skin and is expressed by keratinocytes in the epidermis. Kallikrein-7 / KLK7 is up-regulated in ovarian carcinoma, especially late-stage serous carcinoma, compared with normal ovaries and benign adenomas (at the protein level). It was significantly associated with shorter overall survival (OS) and disease-free survival (DFS). Kallikrein-7 / KLK7 may catalyze the degradation of intercellular cohesive structures in the cornified layer of the skin in the continuous shedding of cells from the skin surface. KLK7 also plays a role in the activation of precursors to inflammatory cytokines.

References

Catalog Number:MGE204-NM