Rat KIT / c-KIT / CD117 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGE173-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2937bp
Gene Synonym
Kit
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). c-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains.and 1 protein kinase domain. It belongs to the protein kinase superfamily, tyr protein kinase family and CSF-1/PDGF receptor subfamily. C-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains and 1 protein kinase domain. C-Kit has a tyrosine-protein kinase activity. Binding of the ligands leads to the autophosphorylation of KIT and its association with substrates such as phosphatidylinositol 3-kinase. Antibodies to c-Kit are widely used in immunohistochemistry to help distinguish particular types of tumour in histological tissue sections. It is used primarily in the diagnosis of GISTs. In GISTs, c-Kit staining is typically cytoplasmic, with stronger accentuation along the cell membranes. C-Kit antibodies can also be used in the diagnosis of mast cell tumours and in distinguishing seminomas from embryonal carcinomas. Mutations in c-Kit gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Defects in KIT are a cause of acute myelogenous leukemia (AML). AML is a malignant disease in which hematopoietic precursors are arrested in an early stage of development. Note=Somatic mutations that lead to constitutive activation of KIT are detected in AML patients.
References
  • Andre C, et al. (1997) Sequence analysis of two genomic regions containing the KIT and the FMS receptor tyrosine kinase genes. Genomics. 39(2):216-26.
  • Yarden Y, et al. (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J. 6(11):3341-51.
  • Leong KG, et al. (2008) Generation of a prostate from a single adult stem cell. Nature. 456(7223): 804-8.
  • Edling CE, et al. (2007) c-Kit--a hematopoietic cell essential receptor tyrosine kinase. Int J Biochem Cell Biol. 39(11):1995-8.
  • McIntyre A, et al. (2005) Amplification and overexpression of the KIT gene is associated with progression in the seminoma subtype of testicular germ cell tumors of adolescents and adults. Cancer Res. 65(18):8085-9.
  • TOP