Mouse jumping translocation breakpoint / JTB Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGE087-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
441bp
Gene Synonym
Gm622
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse jumping translocation breakpoint Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.
References
  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • TOP