Human Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC017202

RefSeq ORF Size

1272bp

Gene Synonym

ACAD2, FLJ12715, FLJ34849, IVD

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human isovaleryl-CoA dehydrogenase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Isovaleryl-CoA dehydrogenase, also known as IVD, plays an essential role in processing proteins obtained from the diet. The body breaks down proteins from food into smaller parts called amino acids. Amino acids can be further processed to provide energy for growth and development. Isovaleryl-CoA dehydrogenase helps process a particular amino acid called leucine. Specifically, isovaleryl-CoA dehydrogenase is responsible for the third step in the breakdown of leucine. This step is a chemical reaction that converts a molecule called isovaleryl-CoA to another molecule, 3-methylcrotonyl-CoA. Additional chemical reactions convert 3-methylcrotonyl-CoA into molecules that are used for energy.

References

BACHHAWAT BK, et al. (1956) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.

Ikeda Y, et al. (1983) Purification and characterization of isovaleryl coenzyme A dehydrogenase from rat liver mitochondria. J Biol Chem. 258(2):1077-85.

Tanaka K, et al. (1966) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.

Catalog Number:MGE042-CM