Rat Insulin Receptor/INSR/CD220 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_017071.2

RefSeq ORF Size

4155bp

Gene Synonym

Insr

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat insulin receptor Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

References

Catalog Number:MGD991-NF