Rat IL7/IL-7/Interleukin-7 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGD959-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
465bp
Gene Synonym
Il1a, IL-1alpha
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 7 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.
References
  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.
  • TOP